This Article Full Text (PDF) References Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Chew, D. S. H. Articles by Leung, M.-Y. Search for Related Content

Palindromes in SARS and Other Coronaviruses

Department of Mathematics, National University of Singapore, Singapore 117543, Singapore
Departments of Mathematics, and of Statistics and Applied Probability, National University of Singapore, Singapore 117543, Singapore
Department of Biology, University of Texas at San Antonio, San Antonio, Texas 78249, USA
Department of Mathematical Sciences, University of Texas at El Paso, El Paso, Texas 79968, USA
matchewd{at}nus.edu.sg
matckp{at}nus.edu.sg
hheidner{at}utsa.edu
mleung{at}utep.edu

With the identification of a novel coronavirus associated with the severe acute respiratory syndrome (SARS), computational analysis of its RNA genome sequence is expected to give useful clues to help elucidate the origin, evolution, and pathogenicity of the virus. In this paper, we study the collective counts of palindromes in the SARS genome along with all the completely sequenced coronaviruses. Based on a Markov-chain model for the genome sequence, the mean and standard deviation for the number of palindromes at or above a given length are derived. These theoretical results are complemented by extensive simulations to provide empirical estimates. Using a z score obtained from these mathematical and empirical means and standard deviations, we have observed that palindromes of length four are significantly underrepresented in all the coronaviruses in our data set. In contrast, length-six palindromes are significantly underrepresented only in the SARS coronavirus. Two other features are unique to the SARS sequence. First, there is a length-22 palindrome TCTTTAACAAGCTTGTTAAAGA spanning positions 25962–25983. Second, there are two repeating length-12 palindromes TTATAATTATAA spanning positions 22712–22723 and 22796–22807. Some further investigations into possible biological implications of these palindrome features are proposed.

Key words: Markov chain; palindrome counts; simulation; RNA viral genome; severe acute respiratory syndrome
History: received August 2003; accepted January 2004.